Who is writing this column?
Dr. Toby Rossman is a professor at the Nelson Institute of Environmental Medicine, New York University School of Medicine. She is Director of the Molecular and Genetic Toxicology research program. She is also a devoted cook, and was one of the finalists a few years ago in the Times Herald Record's cooking contest. Dr. Rossman has been conducting cancer-related research for over 30 years, and has published almost 100 articles in the peer-reviewed scientific literature. Most of her published work is on identification of mutagens and carcinogens (particularly environmental metals), determining their mechanisms of action, and studying how dietary and genetic factors can decrease the effects of these substances. Dr. Rossman receives grant support primarily from the National Institutes of Health and the Environmental Protection Agency. She has long been a consultant to these two agencies, particularly the former, where, as a member of the Metabolic Pathology Study Section, she was a reviewer on numerous grant applications involving diet and cancer. This served to further stimulate her interest in the chemo preventive properties of foods. One of her current NIH grants involves testing dietary substances for their antimutagenic effects.
What are Genetically Modified Foods? (Just the Facts)
In the summer of 1998, I attended the International Genetics Conference in Beijing, China. Although I am not a plant geneticist, I found myself fascinated by many of the scientific sessions dealing with the genetic engineering of plants. There was an assumption, particularly by scientists from the third world, that genetically-modified plants probably hold the most promise for feeding the world in the next century. Yet, there is fear on some parts of the public about the safety of such foods. Some have even called genetically-modified food Frankenstein foods. Here I describe in lay-persons terms exactly what is meant by genetically-modified food and genetically-engineered foods. This article is meant to be factual, not judgmental. I am describing what is, not what should be.
I. All of the food that we eat has been genetically modified. Ever since humans stopped hunting and gathering for a living and became farmers, we have been genetically modifying our food. The products which you buy in the supermarket are all the result of centuries of modification of the original wild type organisms. This is what made agriculture possible. The first plant breeders who domesticated crops such as beans, corn and wheat, could save only those types which would grow in the areas to which they had been transplanted. How were the crops changed? These early plant breeders selected for pest resistance, and tolerance to heat, drought, cool temperatures, and nutrient imbalance. Much of this selection was involuntary. When varieties giving top performance for many seasons in different localities are selected, the result is tolerance to the prevailing stresses and seasonal variations in particular places. This selection changes the genetic makeup of crop species, causing them to divert from their original wild type species. Compare for example teosinte, the probable parent of maize (corn) which is restricted to certain areas of Mexico, with the corn varieties which are grown in nearly every country of the world except Iceland. Crops which are now familiar to us all arose over several thousand years of agriculture. Plant breeders have successfully bred numerous desirable traits into crops, but only by using plants of the same or closely related species. Some new traits appear as a result of natural (sometimes called spontaneous) mutations, but this is a rare event. After World War II, plant seeds were sometimes treated with mutagens such as x-rays in order increase the number of mutants. Mutation means a change in the sequence of bases in a piece of DNA (the gene). These bases are parts of the DNA molecule that can vary in 4 ways, called A, C, G and T for short. (Think of a deck of cards in which the 4 suits can occur in any order such as [Image]). The information contained in a gene consists of about 1000 bases in a particular order (for example, part of a gene might read GCGGTTACCAAGTTCGGAAA). Since the sequence (order) of the bases is what carries the information for making a protein, a change in the sequence of DNA can mean a change in the protein encoded by that gene. (Changing the sequence listed above to GCTGTTACCAAGTTCGGAAA would be a mutation because the third base is changed from a G to a T. A single base change such as this is the difference between the gene for normal hemoglobin and the gene for sickle cell hemoglobin). Plants having desired mutations can be selected and used for breeding purposes. A trait which was desirable but only found in a genetically incompatible plant could not be incorporated into the crop plant using traditional methods. A genetically compatible plant is a close relative which can be cross-bred by cross-pollination. Even when genes from a compatible plant were introduced, breeders must perform numerous crosses and back crosses before they can incorporate the new trait into a marketable variety. For example, a mutation conferring resistance to a disease may appear in a corn plant which is not sweet or has small kernels. Numerous crosses must be made so that sweetness, large kernels and disease resistance genes all occur in the same plant, a process that may take two decades or more.
II. Genetic engineering of foods Genetic engineering allows genes from any organism, not just a genetically compatible close relative, to be added to a plant (or animal, but let's focus on plants here). It is also possible to alter the genes already in the plant, a point that has received less attention than the addition of new genes. To add a new gene, a piece of DNA (which contains the genetic instructions for the desired protein which gives rise to the desired trait) is spliced into a carrier piece of DNA (called a vector) and inserted into the cells of the plant to be modified. There, it can integrate into the DNA of the host plant cell. (Think of cutting and splicing a piece of film or tape). Plant cells are then selected for the expression of the added piece of DNA. New plants are grown up from these cells, and tested for the desired trait. Does this mean that the new plant now takes on some properties of the species from which the inserted gene was derived? When it was reported that a gene encoding an antifreeze protein from fish was going to be inserted into strawberries to make them able to withstand colder temperatures, it was thought by some that this would make the strawberries taste fishy. Not so. Fishiness is caused by a whole different set of fish genes that have nothing whatsoever to do with the antifreeze protein gene. Genetic engineering allows one to insert ONLY the genes that are desired. To continue with the same example, does this mean that each new plant now contains a piece of a fish? This question was brought up by those who worry that if a gene were derived from a non-kosher species, such as a crab, then the resulting food would not be kosher. However, it can be argued that in fact there is no actual crab in a plant even if it contains a sequence derived from a crab. This is because it is a copy of the genetic information which is inserted, and not anything from the crab itself. When scientists have isolated (cloned) and sequenced a gene, the DNA containing that sequence is placed into a vector which is then put into a bacterium. Bacteria grow rapidly, and the vector containing the cloned gene multiplies along with the bacteria. This is the source for genes which will be placed in plants, not the crab itself. In addition, once the sequence is cloned, scientists can alter the sequence in the laboratory to modify its properties, so that it no longer exactly matches the sequence found in nature.
III. What genetically engineered foods are on the market or in the planning stages? Right now there are about 50 genetically altered plant varieties approved by the USDA. In 1998, 48% of soybeans and 36% of corn produced in the US were from genetically-engineered varieties. What are some of the genetically modified foods now being produced or in the planning stages? Some plants now being grown: * Tomatoes containing a synthetic gene that retards softening * Potatoes and corn with insect resistance genes * High oleic soybeans (less saturated fat) * High methionine and lysine grains and soybeans (higher quality protein) * High sucrose soybeans (better taste) * Soybeans and cotton with genes for resistance to weed-killer * Squash with genes for disease resistance * Round-up ready soy beans (resistance to weed-killer Round-up) * Insect-resistant peas Some plants planned: * Fruits with genes encoding other ways of controlling fruit ripening * Plants modified to remove an allergen (e.g. in rice) * Plants producing milk proteins * Low-phytate corn (for animal feed) * Wheat modified for gluten and starch content * Canola oil with high beta-carotene * Rice with high vitamin E * Plants that produce pharmaceuticals * Plants that produce vaccines Sometimes chemical additives manufactured by genetically engineered bacteria are also considered genetically engineered foods. For example, renin, an enzyme used in cheese production, used to be isolated from cow's stomachs. It is now produced by bacteria into which the DNA encoding renin has been inserted.
Green Tea or Black?
Tea is derived from the leaves of a plant discovered in China thousands of years ago. Today, after water, tea drinking accounts the major source of fluid intake to humans in the world. After harvesting, tea leaves are dried rolled and crushed. If the leaves are heated at this point, any enzymes in the tea leaves are inactivated. Tea made from these leaves is green tea. If no heat is applied to the dried leaves, an enzyme called polyphenol oxidase is able to act on some naturally occurring compounds called polyphenols and to convert them to different polyphenols. Oolong tea results when the enzymes have been active for about 30 minutes. After 2 hours, black tea is the result. Worldwide consumption of black tea far exceeds that of green tea. Green tea is consumed mainly in the Far East and North Africa, oolong tea in Taiwan and Southern China, and black tea in the rest of the world. The standard "tea" in the U.S. is black tea. Both green and black tea contain some caffeine, but the amounts in a cup of green or black tea are only one third the amount in a cup of coffee.
There is some evidence, based on human (epidemiological) studies that consumption of green tea lowers the risk for some cancers (stomach, esophagus and lung), as well as reducing the risk of cardiovascular disease. For example, male smokers in Japan have a lower incidence of lung cancer compared to male smokers in the U.S. A large number of studies conducted in the last decade indicate that green tea can protect animals against cancers at a number of sites, including skin, lung, esophagus, breast, and colon. The inhibitory compounds in green tea have been identified as its major polyphenol, a compound abbreviated as EGCG (epigallocatechin gallate) and, to a lesser extent, caffeine. Evidence suggests that the anticarcinogenic action of ECGC is due to its strong antioxidant action as well as its ability to prevent metabolism of carcinogenic compounds to their dangerous (mutagenic) forms. (In a later column, I will discuss these topics in more detail).
The good news is that recent research now indicates that black tea may be just as good at chemoprevention as green tea. In the September 15, 1998 issue of Cancer Research (the journal of the American Association of Cancer Research), scientists from American Health Foundation in Valhalla, NY (right here in the Hudson Valley!) report that lung and liver cancers in rats treated with a carcinogenic tobacco compound can be greatly blocked when the rats drank black tea instead of water. Interestingly, even caffeine alone blocked the tumorigenic action of the tobacco compound! Most lung cancers in humans (as well as many stomach, esophageal and bladder cancers) are attributable to smoking tobacco, which is why smoking (or even being exposed to second hand smoke) is not a good idea. It is possible to avoid exposure to tobacco, but it is not always possible to avoid exposure to other carcinogenic compounds, either because they are ubiquitous in the environment (e.g. ultraviolet light, diesel exhaust) or because they are formed in our own bodies or contained in our food (more on this later). It is possible that drinking tea may have a beneficial chemo preventive effect against these other agents as well, although this still requires scientific proof.
|